| |
In-Silico PCR searches a sequence database with a pair of
PCR primers, using an indexing strategy for fast performance.
See an example
video
on our YouTube channel.
Configuration Options
Genome and Assembly - The sequence database to search.
Target - If available, choose to query transcribed sequences.
Forward Primer - Must be at least 15 bases in length.
Reverse Primer - On the opposite strand from the forward primer. Minimum length of 15 bases.
Max Product Size - Maximum size of amplified region.
Min Perfect Match - Number of bases that match exactly on 3' end of primers. Minimum match size is 15.
Min Good Match - Number of bases on 3' end of primers where at least 2 out of 3 bases match.
Flip Reverse Primer - Invert the sequence order of the reverse primer and complement it.
Append to existing PCR result - Add this PCR result list to the currently existing track of PCR results.
Output
When successful, the search returns a sequence output file in fasta format
containing all sequence in the database that lie between and include the
primer pair. The fasta header describes the region in the database
and the primers. The fasta body is capitalized in areas where the primer
sequence matches the database sequence and in lower-case elsewhere. Here
is an example from human:
>chr22:31000551+31001000 TAACAGATTGATGATGCATGAAATGGG CCCATGAGTGGCTCCTAAAGCAGCTGC
TtACAGATTGATGATGCATGAAATGGGgggtggccaggggtggggggtga
gactgcagagaaaggcagggctggttcataacaagctttgtgcgtcccaa
tatgacagctgaagttttccaggggctgatggtgagccagtgagggtaag
tacacagaacatcctagagaaaccctcattccttaaagattaaaaataaa
gacttgctgtctgtaagggattggattatcctatttgagaaattctgtta
tccagaatggcttaccccacaatgctgaaaagtgtgtaccgtaatctcaa
agcaagctcctcctcagacagagaaacaccagccgtcacaggaagcaaag
aaattggcttcacttttaaggtgaatccagaacccagatgtcagagctcc
aagcactttgctctcagctccacGCAGCTGCTTTAGGAGCCACTCATGaG
The + between the coordinates in the fasta header indicates
this is on the positive strand.
Author
In-Silico PCR was written by Jim Kent.
Interactive use on this web server is free to all.
Sources and executables to run batch jobs on your own server are available free
for academic, personal, and non-profit purposes. Non-exclusive commercial
licenses are also available. Contact Jim for details.
| |